Lopez-Giral, N. et al. published their research in European Food Research and Technology | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. A strong base can deprotonate an alcohol to yield an alkoxide ion (R―O−). For example, sodamide (NaNH2), a very strong base, abstracts the hydrogen atom of an alcohol. Alcohols may be oxidized to give ketones, aldehydes, and carboxylic acids. These functional groups are useful for further reactions. Oxidation of organic compounds generally increases the number of bonds from carbon to oxygen (or another electronegative element, such as a halogen), and it may decrease the number of bonds to hydrogen.COA of Formula: C20H22O8

Phenolic and color characteristics of must and wine obtained from red grapes treated by pulsed electric fields. Efficacy of PEF to reduce maceration time in elaboration of red wines was written by Lopez-Giral, N.;Lopez, R.;Santamaria, P.;Gonzalez-Arenzana, L.;Garde-Cerdan, T.. And the article was included in European Food Research and Technology.COA of Formula: C20H22O8 The following contents are mentioned in the article:

Pulsed elec. fields effect was studied on the physico-chem. and general phenolic composition as color characteristics and stilbene content in must and wine. For this purpose, a continuous pulsed elec. fields equipment was used to treat three red grape varieties of DOCa Rioja. Graciano, Tempranillo and Grenache wines from these grapes were elaborated with different maceration times, 2 days in the untreated sample (control) and the PEF-treated sample (PEF), and normal maceration time in another untreated sample (control-NM). Parameters as color intensity, anthocyanin content, total polyphenol index and tannin content showed no differences between the PEF sample with 2 days of maceration and the control-NM sample, except in the case of Tempranillo wines. Total stilbenes, trans-resveratrol and trans-piceid of Graciano wines elaborated from PEF samples showed a higher concentration than the control wines. Alternatively, PEF wines and control-NM wines showed no differences between them. Tempranillo variety wines presented no differences between the three types of samples. In the Grenache variety, only trans-piceid levels showed differences between control and PEF wines. Moreover, relationship between must and wine characteristics was evaluated and compared between different samples. The trend lines obtained for the CI, TPI and AC parameters for samples of Graciano, Tempranillo and Garnacha indicate that the initial content of compounds extracted significantly affected the days of maceration necessary to obtain the appropriate wine. The results obtained increase the knowledge of pulsed elec. fields as a technol. available for use in the winery to elaborate red wines with reduced maceration time. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6COA of Formula: C20H22O8).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. A strong base can deprotonate an alcohol to yield an alkoxide ion (R―O−). For example, sodamide (NaNH2), a very strong base, abstracts the hydrogen atom of an alcohol. Alcohols may be oxidized to give ketones, aldehydes, and carboxylic acids. These functional groups are useful for further reactions. Oxidation of organic compounds generally increases the number of bonds from carbon to oxygen (or another electronegative element, such as a halogen), and it may decrease the number of bonds to hydrogen.COA of Formula: C20H22O8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Greco, Francesca et al. published their research in Molecules in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin was written by Greco, Francesca;Musumeci, Domenica;Borbone, Nicola;Falanga, Andrea Patrizia;D’Errico, Stefano;Terracciano, Monica;Piccialli, Ilaria;Roviello, Giovanni Nicola;Oliviero, Giorgia. And the article was included in Molecules in 2022.Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and mol. docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico mol. docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the exptl. CD profiles of Pu22 G4 with the corresponding theor. output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the exptl. CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the pos. band, suggesting the utility of this predictive tool for G4 DNA CD investigations. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Giudice, Gaetano et al. published their research in Pest Management Science in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Similar to water, an alcohol can be pictured as having an sp3 hybridized tetrahedral oxygen atom with nonbonding pairs of electrons occupying two of the four sp3 hybrid orbitals. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Novel sustainable strategies to control Plasmopara viticola in grapevine unveil new insights on priming responses and arthropods ecology was written by Giudice, Gaetano;Moffa, Loredana;Niero, Marina;Duso, Carlo;Sandrini, Marco;Vazzoler, Loris Francesco;Luison, Massimiliano;Pasini, Enrico;Chitarra, Walter;Nerva, Luca. And the article was included in Pest Management Science in 2022.Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Reduction of fungicide consumption in agriculture is globally recognized as a priority. Government authorities are fostering research to achieve a reduction of risks associated with conventional pesticides and promoting the development of sustainable alternatives. To address these issues, in the present study, alternative protocols for the control of downy mildew infection in grapevine were compared to the standard protocol. In the first protocol, only resistance inducers were used, comprising a single formulation with Acibenzolar S-Me, laminarin and disodium-phosphonate. The second and third protocols followed the standard protocol but substituted phosphonates with phosphorus pentoxide and Ecklonia maxima extract The results showed that at veraison downy mildew incidence and severity in all tested protocols were significantly reduced compared to nontreated controls on both canopy and bunches. Expression anal. of key genes involved in plant stress response, indicated that the two protocols for phosphites substitution induced a remodulation of salicylic acid (SA) and jasmonic acid (JA), with pos. impact on yields. Anal. of the first protocol revealed that the primed state induced a short delay in bunch ripening, with a shift of carbohydrate metabolism to boost the plant defences, involving an upregulation of defense related-gene, SAR response and a decreased ROS detoxification. Addnl., anal. on the arthropods populations, in parallel with the pos. results achieved using alternatives to conventional fungicides, were enriched by those showing the potential of naturally occurring predators of spider mites. This study provides practical solutions to reduce the environmental impact of treatments for the control downy mildew in viticulture. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Similar to water, an alcohol can be pictured as having an sp3 hybridized tetrahedral oxygen atom with nonbonding pairs of electrons occupying two of the four sp3 hybrid orbitals. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Wang, Yumeng et al. published their research in Frontiers in Pharmacology in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alkyl halides are often synthesized from alcohols, in effect substituting a halogen atom for the hydroxyl group. The most common reactions of alcohols can be classified as oxidation, dehydration, substitution, esterification, and reactions of alkoxides.Related Products of 27208-80-6

A systematic review and meta-analysis of phytoestrogen protects against myocardial ischemia/reperfusion injury: pre-clinical evidence from small animal studies was written by Wang, Yumeng;Shou, Xintian;Fan, Zongjing;Cui, Jie;Xue, Donghua;Wu, Yang. And the article was included in Frontiers in Pharmacology in 2022.Related Products of 27208-80-6 The following contents are mentioned in the article:

Phytoestrogens are a class of natural compounds that have structural similarities to estrogens. They have been identified to confer potent cardioprotective effects in exptl. myocardial ischemia-reperfusion injury (MIRI) animal models. We aimed to investigate the effect of PE on MIRI and its intrinsic mechanisms. A systematic search was conducted to identify PEs that have been validated in animal studies or clin. studies as effective against MIRI. Then, we collected studies that met inclusion and exclusion criteria from Jan. 2016 to Sept. 2021. The SYRCLE′s RoB tool was used to evaluate the quality. Data were analyzed by STATA 16.0 software. The search yielded 18 phytoestrogens effective against heart disease. They are genistein, quercetin, biochanin A, formononetin, daidzein, kaempferol, icariin, puerarin, rutin, notoginsenoside R1, tanshinone IIA, ginsenoside Rb1, ginsenoside Rb3, ginsenoside Rg1, ginsenoside Re, resveratrol, polydatin, and bakuchiol. Then, a total of 20 studies from 17 articles with a total of 355 animals were included in this metaanal. The results show that PE significantly reduced the myocardial infarct size in MIRI animals compared with the control group (p < 0.001). PE treatment significantly reduced the creatine kinase level (p < 0.001) and cTnI level (p < 0.001), increased left ventricular ejection fraction (p < 0.001) and left ventricular fractional shortening (p < 0.001) in MIRI animals. In addition, PE also exerts a significant heart rate lowering effect (p < 0.001). Preclin. evidence suggests that PE can be multi-targeted for cardioprotective effects in MIRI. More large animal studies and clin. research are still needed in the future to further confirm its role in MIRI. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Related Products of 27208-80-6).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alkyl halides are often synthesized from alcohols, in effect substituting a halogen atom for the hydroxyl group. The most common reactions of alcohols can be classified as oxidation, dehydration, substitution, esterification, and reactions of alkoxides.Related Products of 27208-80-6

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Wang, Jian-Dong et al. published their research in Industrial Crops and Products in 2021 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Under appropriate conditions, inorganic acids also react with alcohols to form esters. To form these esters, a wide variety of specialized reagents and conditions can be used. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Simultaneous transformation and extraction of resveratrol from Polygonum cuspidatum using acidic natural deep eutectic solvent was written by Wang, Jian-Dong;Fu, Li-Na;Wang, Li-Tao;Cai, Zi-Hui;Wang, Yan-Qiu;Yang, Qing;Fu, Yu-Jie. And the article was included in Industrial Crops and Products in 2021.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Resveratrol, as a natural antioxidant, has been studied widely for its antioxidant, anti-inflammatory, anti-apoptotic, and anticancer properties. In this study, a strategy was developed to transform and extract resveratrol from Polygonum cuspidatum on the basis of NADES (natural deep eutectic solvent). In the series of adjustments and optimizations by single-factor exptl., the optimum NADES system (choline chloride to oxalic acid was 1:1) and other exptl. conditions were determined, including water content of NADES, solid-liquid ratio, extraction time, extraction temperature and ultrasonic power. At the same time, RSM combined with BBD further optimized the exptl. process, the results obtained by RSM optimization showed that the resveratrol yield of 12.31 mg/g was achieved when solid-liquid ratio was 1:50, temperature was 75°C and time was 80 min. Meantime, the conversion efficiency of polydatin was 96.11% and the content of resveratrol increased 6-fold higher than that of untreated sample. The kinetic of extraction and thermodn. anal. were performed at different extraction temperatures to examine the temperature on the impact of the resveratrol extraction from P. cuspidatum. Et acetate was used for back extraction in order to achieve the recycling of solvent and the recovery of resveratrol from NADES. The results showed that Et acetate had a good extraction effect and NADES still had a high capacity to convert and extract resveratrol after three cycles. In addition, the extracts exhibited superior antioxidant activity with higher content of recovered resveratrol. This established process can therefore be used to extract and recover resveratrol from plants as an environmental, pollution-free alternative approach. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Under appropriate conditions, inorganic acids also react with alcohols to form esters. To form these esters, a wide variety of specialized reagents and conditions can be used. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Selvakumar, Gopika et al. published their research in Applied Biochemistry and Biotechnology in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Because alcohols are easily synthesized and easily transformed into other compounds, they serve as important intermediates in organic synthesis. Grignard and organolithium reagents are powerful tools for organic synthesis, and the most common products of their reactions are alcohols.HPLC of Formula: 27208-80-6

Inhibition of Advanced Glycation End Product Formation in Rat Tail Tendons by Polydatin and p-Coumaric acid: an In Vitro Study was written by Selvakumar, Gopika;Venu, Dhanalakshmi;Kuttalam, Iyappan;Lonchin, Suguna. And the article was included in Applied Biochemistry and Biotechnology in 2022.HPLC of Formula: 27208-80-6 The following contents are mentioned in the article:

Advanced glycation end products (AGEs) formed through non-enzymic glycosylation between a protein and sugar mol. are highly harmful to the human body. In hyperglycemic patients, AGE formation is more due to high glucose circulating in the blood, causing inter and intra mol. crosslinking of collagen leading to reduction of collagen elasticity. This crosslinked collagen develops resistance to matrix metalloproteinases leading to impaired collagen turnover. The aim of this work is to determine the anti-glycation effects of polydatin and p-coumaric acid in preventing collagen crosslinking by incubating rat tail tendons (RTTs) as collagen source in high glucose concentration (50 mM) for a week. The RTTs were then characterized for tensile strength, crosslinking efficiency, CD spectrometry, collagen, glucose, and aldehyde contents. Electrophoresis was carried out to evaluate the level of crosslinking in collagen and the results confirmed the ability of the drugs in preventing complex intermol. crosslink formation induced by non-enzymic glycosylation. CD data showed alteration in the secondary structure of collagen where AGE formation had occurred. More collagen was extracted by pepsin from RTTs treated with glucose alone (6.88 mg/10 mg tendon) when compared with drug-treated groups (4.25, 2.56 mg/10 mg tendon for polydatin and p-coumaric acid, resp.). Tensile strength (20.66% and 18.95%), crosslinking percentage (32.5% and 29.84%), and glucose content (2.3 and 1.8 mg/100 mg) of drug-treated groups were similar to the pos. control (19.07%, 30.13%, and 2.61 mg/100 mg) thus proving the anti-glycation potential of the drugs. Hence, both polydatin and p-coumaric acid could play a pivotal role in preventing AGE formation. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6HPLC of Formula: 27208-80-6).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Because alcohols are easily synthesized and easily transformed into other compounds, they serve as important intermediates in organic synthesis. Grignard and organolithium reagents are powerful tools for organic synthesis, and the most common products of their reactions are alcohols.HPLC of Formula: 27208-80-6

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Shan, Chao et al. published their research in Scientific Reports in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. The oxygen atom of the strongly polarized O―H bond of an alcohol pulls electron density away from the hydrogen atom. This polarized hydrogen, which bears a partial positive charge, can form a hydrogen bond with a pair of nonbonding electrons on another oxygen atom. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Reference of 27208-80-6

Network pharmacology combined with GEO database identifying the mechanisms and molecular targets of Polygoni Cuspidati Rhizoma on Peri-implants was written by Shan, Chao;Ji, Xiaowei;Wu, Zeyu;Zhao, Jin. And the article was included in Scientific Reports in 2022.Reference of 27208-80-6 The following contents are mentioned in the article:

Peri-implants is a chronic disease leads to the bone resorption and loss of implants. Polygoni Cuspidati Rhizoma (PCRER), a traditional Chinese herbal has been used to treat diseases of bone metabolism However, its mechanism of anti-bone absorption still remains unknown. We aimed to identify its mol. target and the mechanism involved in PCRER potential treatment theory to Peri-implants by network pharmacol. The active ingredients of PCRER and potential disease-related targets were retrieved from TCMSP, Swiss Target Prediction, SEA databases and then combined with the Peri-implants disease differential genes obtained in the GEO microarray database. The crossed genes were used to protein-protein interaction (PPI) construction and Gene Ontol. (GO) and KEGG enrichment anal. Using STRING database and Cytoscape plug-in to build protein interaction network and screen the hub genes and verified through mol. docking by AutoDock vina software. A total of 13 active compounds and 90 cross targets of PCRER were selected for anal. The GO and KEGG enrichment anal. indicated that the anti-Peri-implants targets of PCRER mainly play a role in the response in IL-17 signaling, Calcium signaling pathway, Toll-like receptor signaling pathway, TNF signaling pathway among others. And CytoHubba screened ten hub genes (MMP9, IL6, MPO, IL1B, SELL, IFNG, CXCL8, CXCL2, PTPRC, PECAM1). Finally, the mol. docking results indicated the good binding ability with active compounds and hub genes. PCRERs core components are expected to be effective drugs to treat Peri-implants by anti-inflammation, promotes bone metabolism Our study provides new thoughts into the development of natural medicine for the prevention and treatment of Peri-implants. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Reference of 27208-80-6).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. The oxygen atom of the strongly polarized O―H bond of an alcohol pulls electron density away from the hydrogen atom. This polarized hydrogen, which bears a partial positive charge, can form a hydrogen bond with a pair of nonbonding electrons on another oxygen atom. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Reference of 27208-80-6

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Bai, Junqi et al. published their research in Frontiers in Pharmacology in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are weak acids. The most acidic simple alcohols (methanol and ethanol) are about as acidic as water, and most other alcohols are somewhat less acidic. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Computed Properties of C20H22O8

Transformation of stilbene glucosides from Reynoutria multiflora during processing was written by Bai, Junqi;Chen, Wanting;Huang, Juan;Su, He;Zhang, Danchun;Xu, Wen;Zhang, Jing;Huang, Zhihai;Qiu, Xiaohui. And the article was included in Frontiers in Pharmacology in 2022.Computed Properties of C20H22O8 The following contents are mentioned in the article:

The root of Reynoutria multiflora Thunb. Moldenke (RM, syn.: Polygonum multiflorum Thunb.) has been widely used in TCM clin. practice for centuries. The raw R. multiflora (RRM) should be processed before use, in order to reduce toxicity and increase efficiency. However, the content of trans-2, 3, 5, 4′′-tetrahydroxystilbene-2-O-β-D-glucopyranoside (trans-THSG), which is considered to be the main medicinal ingredient, decreases in this process. In order to understand the changes of stilbene glycosides raw R. multiflora (RRM) and processed R. multiflora (PRM), a simple and effective method was developed by ultra high performance liquid chromatog. tandem quadrupole/electrostatic field orbitrap highresoln. mass spectrometry (UHPLC-Q-Exactive plus orbitrap MS/MS). The content and quantity of stilbene glycosideshave undergone tremendous changes during the process. Seven parent nucleus of stilbene glycosides and 55 substituents, including 5-HMF and a series of derivatives, were identified in PM. 146 stilbene glycosides were detected in RRM, The number of detected compounds increased from 198 to 219 as the processing time increased from 4 to 32 h. Among the detected compounds, 102 stilbene glycosides may be potential new compounds And the changing trend of the compounds can be summarized in 3 forms: gradually increased, gradually decreased, first increased and then decreased or decreased first. The content of trans-THSG was indeed decreased during processing, as it was converted into a series of derivatives through the esterification reaction with small mol. compounds The clarification of secondary metabolite group can provide a basis for the follow-up study on the mechanism of pharmacodynamics and toxicity of PM, and for screening of relevant quality markers. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Computed Properties of C20H22O8).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are weak acids. The most acidic simple alcohols (methanol and ethanol) are about as acidic as water, and most other alcohols are somewhat less acidic. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Computed Properties of C20H22O8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Karatas, Dilek Degirmenci et al. published their research in Chemistry & Biodiversity in 2022 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Computed Properties of C20H22O8

Phytochemical Contents of Different Parts of the Seeded Raisins from the South-East Anatolia: Enzyme Inhibitory Potential of Pulp Extracts was written by Karatas, Dilek Degirmenci;Oz, Veysi;Yener, Ismail;Akdeniz, Mehmet;Erek, Figen;Aydin, Isil;Yigitkan, Serkan;Yilmaz, Mustafa Abdullah;Ertas, Abdulselam. And the article was included in Chemistry & Biodiversity in 2022.Computed Properties of C20H22O8 The following contents are mentioned in the article:

In this study, some phytochem. properties of six seeded raisin species that are mainly cultivated in Southeastern Anatolia were investigated. Addnl., some phys. and quality characteristics, phenolic contents (by LC-MS/MS; Liquid Chromatog. Tandem Mass/Mass Spectrometer System), anticholinesterase, and antioxidant capacities (DPPH; 2,2-diphenyl-1-picrylhydrazyl) free-radical scavenging, ABTS; 2,2-azinobis(3-ethylbenzothiazoline-6-sulfonic acid cation-radical scavenging activity and CUPRAC; cupric reducing antioxidant capacity) of the cultivars were investigated on ground raisins. In all three methods, the antioxidant activity values of seed extracts were determined to be higher than those of leaf and pulp extracts Remarkably, the seed extract of Banazi Siyahi showed the highest antioxidant activity in ABTS (IC50: 4.35±0.02μg/mL), DPPH (IC50: 10.78±0.78μg/mL), and CUPRAC (A0.5: 9.33±0.45μg/mL) methods. Addnl., the ethanol extracts of all pulp samples showed higher anticholinesterase activity against acetyl-(AChE) and butyrylcholinesterase (BChE) enzymes than galantamine. According to the LC-MS/MS results, catechin (21.362 mg analyte/g extract) and epicatechin (44.667 mg analyte/g extract) found to be quite rich in Kerkues seed extract and isoquercitrin (116.873 mg analyte/g extract) and astragalin (31.915 mg analyte/g extract) detected to be quite rich in Banazi Siyahi leaf extract Considering the mineral content of the varieties and the soil samples they grow in, all of the grape varieties analyzed in the study was found to be rich. Based on these findings, it might be suggested that Banazi Siyahi and Kerkues varieties have potential to be utilized in pharmaceutical and food industries, due to their contents of catechins, isoquercitrin and astragalin. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Computed Properties of C20H22O8).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Computed Properties of C20H22O8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Zhou, Wenjun et al. published their research in Biomedicine & Pharmacotherapy in 2021 | CAS: 27208-80-6

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alkyl halides are often synthesized from alcohols, in effect substituting a halogen atom for the hydroxyl group. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Jiangzhi Granule attenuates non-alcoholic steatohepatitis by suppressing TNF/NFκB signaling pathway-a study based on network pharmacology was written by Zhou, Wenjun;Zhu, Ziye;Xiao, Xiaoli;Li, Chunlin;Zhang, Li;Dang, Yanqi;Ge, Guangbo;Ji, Guang;Zhu, Mingzhe;Xu, Hongxi. And the article was included in Biomedicine & Pharmacotherapy in 2021.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Jiangzhi Granule is a commonly used traditional Chinese medicine for treating non-alc. fatty liver disease. However, its key ingredients and underlying mechanisms for attenuating nonalcoholic steatohepatitis (NASH) remain unclear. To address this issue, UPLC-TOF-MS based chem. profiling, network pharmacol. and animal exptl. validation were employed. First, a total of 56 main ingredients of Jiangzhi Granule and 38 ingredients in the blood and liver (after oral administration) were identified. Then, 170 potential targets of the absorbed ingredients and 50 targets of NASH were identified, and 10 overlapped genes were identified as candidate targets of Jiangzhi Granule for NASH treatment. A Jiangzhi Granule-ingredients-targets-disease network was constructed using Cytoscape software, which included eight main ingredients (such as emodin, resveratrol and quercetin) and 10 candidate targets (such as TNF, IL6 and CCL2). Functional enrichment indicated that the candidate targets were enriched in multiple pathways (such as the TNF signaling pathway). Furthermore, a NASH mice model was constructed and intervened with Jiangzhi Granule. The results revealed that Jiangzhi Granule could ameliorate NASH characteristics, such as histopathol. changes and liver cholesterol level. Meanwhile, Jiangzhi Granule significantly decreased the mRNA and protein expression of TNFα in NASH mice liver, suppressed NFκB activation, and inhibited the expression of macrophage activation marker F4/80 and M1-type polarization marker CD11b/CD11c. ELISA assay indicated that Jiangzhi Granule reduced pro-inflammatory cytokines (including TNFα, IL-1β and IL-6) in the liver. Collectively, our results suggested that Jiangzhi Granule could attenuate NASH by suppressing TNF/NFκB signaling mediated macrophage M1-type polarization. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alkyl halides are often synthesized from alcohols, in effect substituting a halogen atom for the hydroxyl group. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Recommanded Product: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts